Bioinformatics Asked by user3289492 on December 10, 2020
I want to convert a list of fasta ( protein sequences) in a .text file into corresponding nucleotide sequences. A Google search gives me result of DNA to protein conversion but not vice versa. Also, I came across How do I find the nucleotide sequence of a protein using Biopython?, but this is what I am not looking for. Is there any possible way to do it using python.Moreover, I would like to solve it using python programming. I am sure there must be some way to do it rather than writing a code from scratch. Thanks!
You can't do this because there is redundancy in the genetic code and the same protein sequences can be encoded by different nucleotide sequences. There are 64 codons and ~20 amino acids, e.g. GCT, GCC, GCA and GCG all encode Alanine.
Answered by Chris_Rands on December 10, 2020
Although there is not a unique nucleotide sequence that translates to a given protein, one can list all the possible DNA sequences that do translate to that protein.
An online tool that does just that is Backtranambig, from EMBOSS. It produces a DNA sequence representing all the nucleotide sequences matching the input protein, using IUPAC ambiguity codes.
Answered by PedroSebe on December 10, 2020
DNA Chisel (written in Python) can reverse translate a protein sequence:
import dnachisel
from dnachisel.biotools import reverse_translate
record = dnachisel.load_record("seq.fa")
reverse_translate(str(record.seq))
# GGTCATATTTTAAAAATGTTTCCT
Answered by Peter on December 10, 2020
Get help from others!
Recent Answers
Recent Questions
© 2024 TransWikia.com. All rights reserved. Sites we Love: PCI Database, UKBizDB, Menu Kuliner, Sharing RPP