AnswerBun.com

How to translate amino acid sequences to Nucleotide sequences

Bioinformatics Asked by user3289492 on December 10, 2020

I want to convert a list of fasta ( protein sequences) in a .text file into corresponding nucleotide sequences. A Google search gives me result of DNA to protein conversion but not vice versa. Also, I came across How do I find the nucleotide sequence of a protein using Biopython?, but this is what I am not looking for. Is there any possible way to do it using python.Moreover, I would like to solve it using python programming. I am sure there must be some way to do it rather than writing a code from scratch. Thanks!

3 Answers

You can't do this because there is redundancy in the genetic code and the same protein sequences can be encoded by different nucleotide sequences. There are 64 codons and ~20 amino acids, e.g. GCT, GCC, GCA and GCG all encode Alanine.

Answered by Chris_Rands on December 10, 2020

Although there is not a unique nucleotide sequence that translates to a given protein, one can list all the possible DNA sequences that do translate to that protein.

An online tool that does just that is Backtranambig, from EMBOSS. It produces a DNA sequence representing all the nucleotide sequences matching the input protein, using IUPAC ambiguity codes.

Answered by PedroSebe on December 10, 2020

DNA Chisel (written in Python) can reverse translate a protein sequence:

import dnachisel
from dnachisel.biotools import reverse_translate

record = dnachisel.load_record("seq.fa")
reverse_translate(str(record.seq))
# GGTCATATTTTAAAAATGTTTCCT

Answered by Peter on December 10, 2020

Add your own answers!

Related Questions

Generating 3D coordinates error

1  Asked on January 15, 2021 by shahbaaz

   

BAM file filteing to remain best isoform

0  Asked on January 10, 2021 by user977828

         

Somatic mutations for normal WES samples

0  Asked on January 6, 2021 by lot_to_learn

     

Get list of urls of GSM data set of a GSE set

1  Asked on January 6, 2021 by user432797

       

Biohackers Netflix – DNA to binary and video

1  Asked on January 3, 2021 by xamax

     

DNA sequence error annotation

0  Asked on December 30, 2020 by matthew-jones

     

samtools / bamUtil | Meaning of as Reference Name

1  Asked on December 25, 2020 by paul-endymion

   

How to remove batch effect from TCGA and GTEx data

2  Asked on December 22, 2020 by kai-he

   

Ask a Question

Get help from others!

© 2023 AnswerBun.com. All rights reserved. Sites we Love: PCI Database, MenuIva, UKBizDB, Menu Kuliner, Sharing RPP, SolveDir