AnswerBun.com
  1. All Categories
  2. Bioinformatics

Bioinformatics : Recent Questions and Answers (Page 4)

Find answers to your questions about Bioinformatics or help others by answering their Bioinformatics questions.

Is there a way to measure cell line similarity using python?

I have a list of cell lines that should be compared against another list of cell lines as pairs. I am trying to find a way in order for me...

Asked on 11/17/2021

1 answer

P-value correction when evaluating correlation between gene and miRNA expression

First of all I apologize without the question is very basic, I am taking my first steps in bioinformatics.Data informationWe are evaluating the correlation (using the Pearson, Kendall or Spearman...

Asked on 11/15/2021

1 answer

Separating peaks of chip-seq with specific length

My data contain several chip-seq results. I have the peaks called by MACS2.I wanted to only look at those peaks that their size is e.g 500bp to 1000bp. How can...

Asked on 11/15/2021

2 answer

How to run MaxQuant in command line mode?

MaxQuant is a software package for mass spectroscopy and proteomics. There is a windows version and a linux version. To run on linux you have to use a program that...

Asked on 11/12/2021

2 answer

Why does the FASTA sequence for coronavirus look like DNA, not RNA?

I'm looking at a genome sequence for 2019-nCoV on NCBI. The FASTA sequence looks like this:>MN988713.1 Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genomeATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG... ...TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAACoronavirus...

Asked on 11/12/2021

4 answer

How to extract metadata from NCBI's experiment?

I want to extract metadata from experiment SRX1596422. I have sratoolkit and Entrex direct but not sure what line of code to use. Here's the link for the experiment: ...

Asked on 11/12/2021

1 answer

Viral Metagenomics

I am analyzing viral metagenomics data (Illumina Miseq) for the first time. I have used Ray for de novo viral genome assembly before but I haven't done...

Asked on 11/10/2021

1 answer

How to map short sequences to long reads, recovering all multiply-mapped high-quality matches

The dilemma:I have around one million short sequences (21 bp to several 100s of basepairs) for which I need to identify all occurrences of in 20-30x coverage noisy long reads...

Asked on 11/10/2021

1 answer

How identifiable are human omics data and how to mitigate their identifying features?

Say a database were to store human omics datasets. The human subjects are known and the sample size is rather small in size initially (n=500). The database contains genomics, transcriptomics,...

Asked on 11/04/2021

2 answer

How to get transcriptome FASTA file for viruses for Kallisto pseudo-alignment?

I guess the title is self-explanatory. I'd like to find the reference transcriptome files for a few human viruses. My RNA-seq samples are from human tumor cells that were infected...

Asked on 10/06/2021

2 answer

Ask a Question

Get help from others!

© 2023 AnswerBun.com. All rights reserved. Sites we Love: PCI Database, MenuIva, UKBizDB, Menu Kuliner, Sharing RPP, SolveDir